Team:Heidelberg LSL/Notebook-12/02/2012

• Home
• Team
  • Overview
  • Participants
  • Advisors
  • Scientific Environment
  • Gallery
  • Acknowledgements
• Project
  • Abstract
  • Introduction
  • Sensor Construction
  • Measurements
  • Human Practice
  • Summary & Outlook
  • References
• Parts
• Notebook
  • Notebook-Timeline
  • Materials
  • Methods
  • Safety
• Online Store
• Sponsors

Notebook

Welcome to our notebook!

Here you will find the documentation of our laboratory work of the last few month in diary form. This notebook comprises the work in three phases:

Planing and Development - 25/02/2012

Miniprep of parts BBa_K173004,BBa_ E0240 and BBa_J22106 by using a Qiagen Miniprep Kit Protocol: 4 ml bacterial culture is pelleted by centrifugation at 10.000 rpm for 1 min. Afterwards, the pellet is resuspended in 250 ul buffer P1. 250 ul buffer P2 are added and the culture is gently inverted and incubated for 5 min. 350 ul buffer N3 are added and the suspension is centrifuged at 13.000 rpm for 10 min. The supernatant is subsequently loaded onto a miniprep column and centrifuged for 1 min/max speed. Afterwards the column is washed with buffer PB (500 ul) and buffer PE (750 ul) by loading onto the column and subsequent centrifugation for 1 min/max speed. After a last centrifugation step for drying the column (again 1 min/max speed), 50 ul of water are added in order to dissolve the DNA again. After 1 min incubation, DNA is eluted by centrifugation for 1 min/max speed.
Measurement of DNA concentration at the Nanodrop micophotometer device 1 ul of water is used as blank. Subsequently, the miniprep cultures ( 1ul each) were loaded onto the Nanodrop device in order to determine the concentration and purity of the DNA in the samples. Concentrations ranged from 70 ng/ul to 300 ng/ul ( hier muss die Tabelle mit den Konzentrationen rein).
Digestion of Minipreps for further cloning We used the NEB restriction enzymes and buffers for setting up the digestions. Those were done as follows: - 1 ug of DNA - 3 ul of NEB buffer 2 - 3 ul of BSA - 1 ul of each restriction enzyme used - Water was added to reach a final volume of 30 ul GFP (BBa_ E0240) and LacZ (BBa_K173004) were digested with EcoRI and XbaI. RecA (BBa_J22106) was digested with EcoRI and SpeI. After setting up the digestions, the reaction mixtures were mixed briefly, spinned down in a centrifuge (quick run up to 5.000 rpm) and then incubated on a thermomixer heating device for 1 h at 37 °C and stored at -20 °C afterwards.

Annealing of SulA oligos:
SulA_fw: aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatcc aactcacc
SulA_rev: ctagggtgagttactgtatggatgtacagtacatccagtgacaacaaagatcaacccctctagaagcggccgcg
The Oligos for the synthesis of the SulA promoter were designed according to the sequence available in the partsregistry (BBa_K518010). By annealing of the oligos and ligation into a EcoRI/XbaI precut biobrick construct, they reconstitute the biobrick standard prefix completely and introduce the SulA promoter sequence.
Protocol: 5 ul of each oligo (diluted to a concentration of 100 mM) and 5 ul of NEB buffer 2 were added to 35 ul of water. After mixing, the reaction mix was heated up to 95 °C/5 min and then cooled down slowly to room temperature and then stored at -20 °C.