Team:Heidelberg LSL/Notebook

From 2012hs.igem.org

Revision as of 14:56, 9 June 2012 by Sholderbach (Talk | contribs)

iGEM-2012HS - LSL-Heidelberg iGEM-2012HS - LSL-Heidelberg



Notebook

Welcome to our notebook!

Here you will find the documentation of our laboratory work of the last few month in diary form. This notebook comprises the work in three phases:

            
Planning and
Development
            
            
Biosensor
Construction
              
            
Calibration and
Characterization
              

 

 

 

 

 

 

 

 

 

 

 

 

 

Notebook

Planing and Development

02/23/2012

02/23/2012

02/23/2012

02/23/2012

02/23/2012

Biosensor Construction

02/23/2012

  • Transformation of GFP (BBa_ E0240) and RecA (BBa_J22106) from registry 2010 spring distribution into E. coli Top10 cells

Protocol:
10 ul water is added to the corresponding well, DNA is solved by incubation for 15 min at room temperature. 5 ul of DNA solution are added to 50 ul of chemocompetent Top10 cells and incubated on ice for 20 min. Afterwards, a heat shock is performed by incubation the bacteria on 42°C/50 s. After another 2 min on ice, the bacteria are plated onto LB-Amp agar plates.

02/24/2012

  • Inoculation of overnight cultures by picking one single colony from the transformed plates and adding it to 5 ml LB-Amp in a 50 ml falcon tube. The culture is incubated at 37 °C at 180 rpm.


  • Inoculation of LacZ (BBa_K173004) that we got from the registry through the Sourjik Lab on campus as agar stick into 5 ml LB Amp overnight culture

02/25/2012

  • Miniprep of parts BBa_K173004,BBa_ E0240 and BBa_J22106 by using a Qiagen Miniprep Kit

Protocol: 4 ml bacterial culture is pelleted by centrifugation at 10.000 rpm for 1 min. Afterwards, the pellet is resuspended in 250 µl buffer P1. 250 µl buffer P2 are added and the culture is gently inverted and incubated for 5 min. 350 µl buffer N3 are added and the suspension is centrifuged at 13.000 rpm for 10 min. The supernatant is subsequently loaded onto a miniprep column and centrifuged for 1 min/max speed. Afterwards the column is washed with buffer PB (500 µl) and buffer PE (750 µl) by loading onto the column and subsequent centrifugation for 1 min/max speed. After a last centrifugation step for drying the column (again 1 min/max speed), 50 µl of water are added in order to dissolve the DNA again. After 1 min incubation, DNA is eluted by centrifugation for 1 min/max speed.

  • Measurement of DNA concentration at the Nanodrop micophotometer device

1 µl of water is used as blank. Subsequently, the miniprep cultures ( 1µl each) were loaded onto the Nanodrop device in order to determine the concentration and purity of the DNA in the samples. Concentrations ranged from 70 ng/µl to 300 ng/µl

(PLACEHOLDER: table of DNA concentration).

  • Digestion of Minipreps for further cloning

We used the NEB restriction enzymes and buffers for setting up the digestions. Those were done as follows:

    • 1 µg of DNA
    • 3 µl of NEB buffer 2
    • 3 µl of BSA
    • 1 µl of each restriction enzyme used
    • Water was added to reach a final volume of 30 ul

GFP (BBa_ E0240) and LacZ (BBa_K173004) were digested with EcoRI and XbaI. RecA (BBa_J22106) was digested with EcoRI and SpeI. After setting up the digestions, the reaction mixtures were mixed briefly, spinned down in a centrifuge (quick run up to 5.000 rpm) and then incubated on a thermomixer heating device for 1 h at 37 °C and stored at -20 °C afterwards.

  • Annealing of SulA oligos:

SulA_fw:

aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccaactcacc

SulA_rev:

ctagggtgagttactgtatggatgtacagtacatccagtgacaacaaagatcaacccctctagaagcggccgcg

The Oligos for the synthesis of the SulA promoter were designed according to the sequence available in the partsregistry (BBa_K518010). By annealing of the oligos and ligation into a EcoRI/XbaI precut biobrick construct, they reconstitute the biobrick standard prefix completely and introduce the SulA promoter sequence.

Protocol: 5 ul of each oligo (diluted to a concentration of 100 mM) and 5 µl of NEB buffer 2 were added to 35 µl of water. After mixing, the reaction mix was heated up to 95 °C/5 min and then cooled down slowly to room temperature and then stored at -20 °C.

03/10/2012

  • Information: Standard cloning - our Strategy
    • GFP and LacZ were digested with EcoRI (E) and Xbal (X)
    • RecA was digested with EcoRI and SpeI (S)
    • SulA was annealed, so it has the overhangs for EcoRI (as well as the whole BBa prefix) and a XbaI compatible overhang


(PLACEHOLDER: schema of cloning)

  • Gelelectrophoresis of the digested biobrick parts in order to extract the GFP and LacZ backbone as well as recA

Protocol: In the meantime, the restriction digests were mixed with 6 µl of 6 x Loading Dye (fermentas). The whole restriction digest was loaded onto a 1 % agarose gel. Therefor, the agarose gel was prepared by adding 2 g of agarose to 200 ml of 1x TBE buffer and heated up in a microwave for 2 min/600 W. Thereby, the agarose was melted. Afterwards, the gel was stirred on a magnetic stirring device until the solution reached ~ 60°C and then the gel was poured. 10 µl of ethidium bromide were subsequently added by our supervisor Katharina Genreith (as EtBr is very toxic, we preferred our supervisor to do the handling of that when running a gel for the first time). The samples were then loaded on the gel together with 1kb plus loading ladder (fermentas) and run for 1 h @ 100V. The expected bands can be seen on the figure (picture constructed using the WinSerial Cloner software).

(PLACEHOLDER: figure showing the gel we expect)

(PLACEHOLDER: photo of the gel)

  • Gel extraction of the indicated band (backbones for LacZ and GFP as well as recA insert) was done using a Qiagen gel extraction kit.

Protocol: The bands were cut of the gel under UV light (caution: wear goggles in order to protect your eyes!) using a scalpel and the extracted band was put into a 2 ml eppi cup. Afterwards, 600 µl of buffer QG were added to each gel band and the mixture was incubated on a thermomixer device at 50 °C and 700 rpm shaking for 20 min. Afterwards, 200 µl of Isopropanol were added to the mix containing recA (as recA is pretty short compared to the others, isopropanol is required). Afterwards, the whole reaction mix was loaded onto a gel extraction column and centrifuged for 1 min/max speed; flow-through was discarded. The column was subsequently washed with 500 µl of buffer QG and then 750 µl buffer PE, always centrifuging the column at max speed for 1 min at each washing step and discarding the flow-through. Finally, DNA was eluted in 20 µl of water.

  • Concentration measurement of the pre-cut parts using Nanodrop
PartDNA concentration
GFP12.5 ng/µl
LacZ15.11 ng/µl
RecA6.0 ng/µl

03/13/2012

03/14/2012

03/15/2012

03/16/2012

03/17/2012

05/08/2012

05/26/2012

Calibration and Characterization

04/27/2012

04/28/2012

04/29/2012

05/27/2012

05/28/2012