Team:Heidelberg LSL/Notebook materials
From 2012hs.igem.org
Kits for Plasmid and DNA purification
Name | Product Description | Company |
small scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains | Promega | |
small scale plasmid purification from E. coli Top10 cells before sequencing | Qiagen | |
medium scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains | Promega | |
direct purification of DNA after restriction digests | Qiagen | |
Purification of DNA fragements from agarose gel | Qiagen |
Enzymes
Name | Product Description | Company |
restriction enzyme, recognition sequence: GAATTC | Promega or NEB | |
restriction enzyme, recognition sequence: ACTAGT | Promega or NEB | |
restriction enzyme, recognition sequence: TCTAGA | Promega or NEB | |
restriction enyzme, recognition sequence: CTGCAG | Promega or NEB | |
Ligation of DNA fragments | Promega or Fermentas | |
Standard Taq PCR master mix for robust amplification of DNA-Fragments by PCR; used for colony-PCR screens | Fermentas |
Oligonucleotides
Oligos were annealed and subsequently cloned into EcoRI/XbaI predigested reporter backbones. Thereby short synthetic DNA-sequences (in this case for the promoters psulA, precA and precB) can be generated in a fast and easy manner.
Oligo Name | Oligo Sequence | sequence length |
SulA_fw | aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccatacagtaactcacc | 74 |