Team:Heidelberg LSL/Notebook

From 2012hs.igem.org

(Difference between revisions)
Line 153: Line 153:
<h4><a style="color:#168dc4;" name="02/23/2012">02/23/2012</a></h4>
<h4><a style="color:#168dc4;" name="02/23/2012">02/23/2012</a></h4>
</html>
</html>
-
*<b>Transformation of GFP (BBa_ E0240) and RecA (BBa_J22106) from registry 2010 spring distribution into E. coli Top10 cells</b><br /><br />
+
*<b>Transformation of GFP (BBa_ E0240) and RecA (BBa_J22106) from registry 2010 spring distribution into <i>E. coli</i> Top10 cells</b><br /><br />
<b>Protocol:</b><br />
<b>Protocol:</b><br />
10 ul water is added to the corresponding well, DNA is solved by incubation for 15 min at room temperature. 5 ul of DNA solution are added to 50 ul of chemocompetent Top10 cells and incubated on ice for 20 min. Afterwards, a heat shock is performed by incubation the bacteria on 42°C/50 s. After another 2 min on ice, the bacteria are plated onto LB-Amp agar plates.
10 ul water is added to the corresponding well, DNA is solved by incubation for 15 min at room temperature. 5 ul of DNA solution are added to 50 ul of chemocompetent Top10 cells and incubated on ice for 20 min. Afterwards, a heat shock is performed by incubation the bacteria on 42°C/50 s. After another 2 min on ice, the bacteria are plated onto LB-Amp agar plates.
Line 250: Line 250:
**Incubation for 50 min at room temperature
**Incubation for 50 min at room temperature
**Heat inactivation of the T4 ligase at 70 °C for 5 min
**Heat inactivation of the T4 ligase at 70 °C for 5 min
-
*Afterwards, 10 µl of the ligation mix (chilled) were used for transforming 50 µl of E. coli Top10 chemocompetent cells.
+
*Afterwards, 10 µl of the ligation mix (chilled) were used for transforming 50 µl of <i>E. coli</i> Top10 chemocompetent cells.
<html>
<html>
<h4><a style="color:#168dc4;" name="03/14/2012">03/14/2012</a></h4>
<h4><a style="color:#168dc4;" name="03/14/2012">03/14/2012</a></h4>
Line 435: Line 435:
</html>
</html>
-
Transformation of E.coli strain BL21 (DE3) with our constructs the samples were plated on LB agarplates with Ampicillin.
+
Transformation of <i>E.coli</i> strain BL21 (DE3) with our constructs the samples were plated on LB agarplates with Ampicillin.
<html>
<html>

Revision as of 21:03, 16 June 2012

iGEM-2012HS - LSL-Heidelberg iGEM-2012HS - LSL-Heidelberg



Notebook

Welcome to our notebook!

Here you will find the documentation of our laboratory work of the last few month in diary form. This notebook comprises the work in three phases:

            
Planning and
Development
            
            
Biosensor
Construction
              
            
Calibration and
Characterization
              

 

 

 

 

 

 

 

 

 

 

 

 

 

Planning and Development

01/07/2012

Brainstorming for possible project ideas:

Ideas:

  • plastics deteriorating bacteria
  • anti pus bacteria against acne
  • bacterial radiation badge
  • bacteria which provide lactose intolerant people with lactase


Members should find out more about the different projects:

  • find pros and cons
  • did a group already work on these ideas?
  • implementation?
  • possible BioBricks?

01/21/2012

Presentation of the information we found:

  • vote and decision → our project for iGEM: bacterial radiation badge


Finding ideas to realize our project:

  • implementing our project using the system of the SOS response

=> find promoters that are part of the SOS response

  • how can we make the DNA damage visible that is caused by radiation?

=> looking for appropriate reporter genes

Work division:

  • reporter group
  • promoter group

02/04/2012

Presentation of results by both groups:

  • classification of possible promotors and reporters
  • we choose recA- (recB-, recC-, ...) and sulA-promotors and lacZ and GFP as reporters


Working out the construction of our plasmids:

Decision on BioBricks we want to order:

  • BBa_K173004 (Beta- galactosidase protein generator)
  • BBa_K173004 (not present in any distribution)
  • BBa_J22106 (2011 spring distribution, kit plate 1, well 9N, backbone: pSB1A2, resistance: Amp)
  • BBa_E0240 (2011 spring distribution, kit plate 1, well 12M, backbone: pSB1A2, resistance: Amp)
  • pSB1A2 (2011 spring distribution, kit plate 1, well 11P, resistance: Amp)
  • pSB1K3 (2011 spring distribution, kit plate 1, well 5A, resistance: Kan)
  • pSB1C3 (2011 spring distribution, kit plate 1, well 3A, resistance: Cm)

02/06/2012

Parts were ordered at iGEM HQ and forms sent to:

Dr. Barbara Di Ventura
BioQuant, 3. OG
INF267
69120 Heidelberg
Germany

02/19/2012

To do:

  • laboratory planning
  • looking for appropriate protocols
  • looking for a lab → DKFZ, Heidelberg: Prof. Dr. Stephan Herzig


Problem: SulA is not available at the parts registry → we have to order the sequence of SulA, which was found in the parts registry, as oligos and aneal them to double-stranded DNA.

"Life as a toolkit"
Ethically considerations about synthetic biology with Dr. Kartin Platzer and Dr. Markus Thiemel

06/02/2012

Planning of the Wiki:

  • structure
  • design
  • header
  • sub points of the menue
  • idea of our "Online Store"


Working on our jewelry :

  • idea with small tubes, which are filled with our bacterial suspension
  • design of bracelets and necklaces for men and women
  • tinkering of jewelry
  • taking photographs of the collection

06/09/2012

Working in groups:

  • working on the Wiki
    • Online Store
      • Check Out
    • Notebook
      • desingn
      • content
    • Project
      • Introduction
      • Results


Biosensor Construction


02/23/2012

  • Transformation of GFP (BBa_ E0240) and RecA (BBa_J22106) from registry 2010 spring distribution into E. coli Top10 cells

Protocol:
10 ul water is added to the corresponding well, DNA is solved by incubation for 15 min at room temperature. 5 ul of DNA solution are added to 50 ul of chemocompetent Top10 cells and incubated on ice for 20 min. Afterwards, a heat shock is performed by incubation the bacteria on 42°C/50 s. After another 2 min on ice, the bacteria are plated onto LB-Amp agar plates.

02/24/2012

  • Inoculation of overnight cultures by picking one single colony from the transformed plates and adding it to 5 ml LB-Amp in a 50 ml falcon tube. The culture is incubated at 37 °C at 180 rpm.


  • Inoculation of LacZ (BBa_K173004) that we got from the registry through the Sourjik Lab on campus as agar stick into 5 ml LB Amp overnight culture

02/25/2012

  • Miniprep of parts BBa_K173004,BBa_ E0240 and BBa_J22106 by using a Qiagen Miniprep Kit

Protocol: 4 ml bacterial culture is pelleted by centrifugation at 10.000 rpm for 1 min. Afterwards, the pellet is resuspended in 250 µl buffer P1. 250 µl buffer P2 are added and the culture is gently inverted and incubated for 5 min. 350 µl buffer N3 are added and the suspension is centrifuged at 13.000 rpm for 10 min. The supernatant is subsequently loaded onto a miniprep column and centrifuged for 1 min/max speed. Afterwards the column is washed with buffer PB (500 µl) and buffer PE (750 µl) by loading onto the column and subsequent centrifugation for 1 min/max speed. After a last centrifugation step for drying the column (again 1 min/max speed), 50 µl of water are added in order to dissolve the DNA again. After 1 min incubation, DNA is eluted by centrifugation for 1 min/max speed.

  • Measurement of DNA concentration at the Nanodrop micophotometer device

1 µl of water is used as blank. Subsequently, the miniprep cultures ( 1µl each) were loaded onto the Nanodrop device in order to determine the concentration and purity of the DNA in the samples. Concentrations ranged from 70 ng/µl to 300 ng/µl

PartDNA concentration
GFP148,52 ng/µl
LacZ361,65 ng/µl
RecA98,61 ng/µl


  • Digestion of Minipreps for further cloning

We used the NEB restriction enzymes and buffers for setting up the digestions. Those were done as follows:

    • 1 µg of DNA
    • 3 µl of NEB buffer 2
    • 3 µl of BSA
    • 1 µl of each restriction enzyme used
    • Water was added to reach a final volume of 30 ul

GFP (BBa_ E0240) and LacZ (BBa_K173004) were digested with EcoRI and XbaI. RecA (BBa_J22106) was digested with EcoRI and SpeI. After setting up the digestions, the reaction mixtures were mixed briefly, spinned down in a centrifuge (quick run up to 5.000 rpm) and then incubated on a thermomixer heating device for 1 h at 37 °C and stored at -20 °C afterwards.

  • Annealing of SulA oligos:

psulA_fw:

aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccaactcacc

psulA_rev:

ctagggtgagttactgtatggatgtacagtacatccagtgacaacaaagatcaacccctctagaagcggccgcg

The Oligos for the synthesis of the SulA promoter were designed according to the sequence available in the partsregistry (BBa_K518010). By annealing of the oligos and ligation into a EcoRI/XbaI precut biobrick construct, they reconstitute the biobrick standard prefix completely and introduce the SulA promoter sequence.

Protocol: 5 ul of each oligo (diluted to a concentration of 100 mM) and 5 µl of NEB buffer 2 were added to 35 µl of water. After mixing, the reaction mix was heated up to 95 °C/5 min and then cooled down slowly to room temperature and then stored at -20 °C.

03/10/2012

  • Information: Standard cloning - our Strategy
    • GFP and LacZ were digested with EcoRI (E) and Xbal (X)
    • RecA was digested with EcoRI and SpeI (S)
    • SulA was annealed, so it has the overhangs for EcoRI (as well as the whole BBa prefix) and a XbaI compatible overhang



  • Gelelectrophoresis of the digested biobrick parts in order to extract the GFP and LacZ backbone as well as recA

Protocol: In the meantime, the restriction digests were mixed with 6 µl of 6 x Loading Dye (fermentas). The whole restriction digest was loaded onto a 1 % agarose gel. Therefor, the agarose gel was prepared by adding 2 g of agarose to 200 ml of 1x TBE buffer and heated up in a microwave for 2 min/600 W. Thereby, the agarose was melted. Afterwards, the gel was stirred on a magnetic stirring device until the solution reached ~ 60°C and then the gel was poured. 10 µl of ethidium bromide were subsequently added by our supervisor Katharina Genreith (as EtBr is very toxic, we preferred our supervisor to do the handling of that when running a gel for the first time). The samples were then loaded on the gel together with 1kb plus loading ladder (fermentas) and run for 1 h @ 100V. The expected bands can be seen on fig. 1.


Fig. 1: Schema of the gel we expect based on the length(picture constructed using the WinSerial Cloner software)


Fig. 2: Picture taken of the gel. All expected bands are visible

  • Gel extraction of the indicated band (backbones for LacZ and GFP as well as recA insert) was done using a Qiagen gel extraction kit.

Protocol: The bands were cut of the gel under UV light (caution: wear goggles in order to protect your eyes!) using a scalpel and the extracted band was put into a 2 ml eppi cup.


Fig. 3: Picture taken of the cut gel. This picture was taken after the required bands were excised for gel extraction

Afterwards, 600 µl of buffer QG were added to each gel band and the mixture was incubated on a thermomixer device at 50 °C and 700 rpm shaking for 20 min. Afterwards, 200 µl of Isopropanol were added to the mix containing recA (as recA is pretty short compared to the others, isopropanol is required). Afterwards, the whole reaction mix was loaded onto a gel extraction column and centrifuged for 1 min/max speed; flow-through was discarded. The column was subsequently washed with 500 µl of buffer QG and then 750 µl buffer PE, always centrifuging the column at max speed for 1 min at each washing step and discarding the flow-through. Finally, DNA was eluted in 20 µl of water.

  • Concentration measurement of the pre-cut parts using Nanodrop
PartDNA concentration
GFP12.5 ng/µl
LacZ15.11 ng/µl
RecA6.0 ng/µl

03/13/2012

  • Ligation reactions were set up using 3-6 fold access of insert (RecA) and 50 ng of each backbone (roughly).
      • RecA-GFP: 4 µl (~50 ng) GFP-backbone + 1,5 µl (~9 ng) RecA + 2 µl T4 DNA ligase buffer + 11,5 µl water + 1 µl T4 ligase
      • RecA-LacZ: 3 µl (~50 ng) LacZ-backbone + 1,5 µl (~9 ng) RecA + 2 µl T4 DNA ligase buffer + 12 µl water + 1 µl T4 ligase
      • SulA-GFP: 4 µl (~50 ng) GFP-backbone + 1 µl annealed SulA-oligos + 2 µl buffer + 12 µl water + 1 µl T4 ligase
      • SulA-LacZ: 3 µl (~50 ng) LacZ-backbone + 1 µl annealed SulA-oligos + 2 µl buffer + 13 µl water + 1 µl T4 ligase
    • Incubation for 50 min at room temperature
    • Heat inactivation of the T4 ligase at 70 °C for 5 min
  • Afterwards, 10 µl of the ligation mix (chilled) were used for transforming 50 µl of E. coli Top10 chemocompetent cells.

03/14/2012

  • Screening of the four different biobrick clonings done by colony-PCR.

Protocol:
A reaction mix was prepared containing 0.2 µl of each screening primer used for the screening, 9.6 µl of water and 10 µl of 2x PCR mastermix (fermentas). Finally a colony was picked from a plate using a sterile pipette tip and was dipped into the PCR mix a few times. 7-8 clones were screened for each different cloning setup as follows:

    • SulA-GFP and SulA-LacZ: primers SulA_fw and VR (standard sequencing primer) were used. Only in case SulA was successfully cloned into the backbone containing the reporter gene, we would get a PCR product. GFP would give a product of roughly 1000 bp, LacZ one of roughly 3500 bp.
    • RecA-GFP and RecA-LacZ: primers VF2 and VR (standard sequencing primers) were used. We compared the product size of the different clones to the product size from the original vectors from the registry (only containing recA or LacZ). In case the cloning was successful, we should see a 200 bp shift in product size, which can be detected by gel electrophoresis.

The PCR program was done as follows:

94°C/3min||94°C/30s|60°C/30s|72°C/3min 45s||30x 72°C/10min|4°C/forever

Afterwards, 3 ul PCR product were loaded onto a 1 % agarose gel.



Fig. 1 Colony-PCR screen of RecA-GFP construct. No detectable shift of any screened clone can be seen compared to the control. Screen has to be repeated.


Fig. 2 Colony-PCR screen of RecA-LacZ construct. Most clones show a small shift upwards in product length. Furthermore, they show a second band at 1200 bp, probably due to unspecific primer binding.


Fig. 3 Colony-PCR screen of SulA-GFP (#3.1-3.8) and SulA-LacZ (#4.1-4.8). Only clones containing the SulA promoter can give a PCR product of 1000 bp (SulA-GFP) or 3700 bp (SulA-LacZ). Positive clones are i.e. #3.4, #4.2, #4.8.

The screening gave positive clones for all constructs (fig. 2, fig. 3), but not the recA-GFP construct (fig. 1). Therefore this screen has to be repeated using a larger number of colonies.

  • 5 ml LB-Amp overnight cultures were inoculated for clones #2.3, #3.4 and #4.8.

03/15/2012

  • The colony-PCR for the recA-GFP construct was repeated, now screening a number of 31 colonies. As control, again the amplicon of the original GFP biobrick was used.



Fig. 1 Repetition of colony-PCR for RecA-GFP construct. Clones #6, 18 and 26 were positive (shift in amplicon length of ~200 bp).

3 positive colonies were detected, as they show a shift in band size of ~ 200 bp as expected by the introduction of the recA promoter. Those were clones # 6, 18 and 26.

  • O/n LB-amp cultures were inoculated for clones #18 and #26.


  • Miniprep of the o/n cultures inoculated the day before for clones #2.3, 3.4 and 4.8 were done.
    • concentrations measured using Nanodrop are all in between 70 and 140 ng/µl


  • Test digestions were performed in order to detect, whether the constructs would give the expected band patterns on the gel.
    • #2.3 with EcoRI/BglI; as control the original LacZ biobrick was digested EcoRI/BgII as well
    • #3.4 and #4.8 were digested NotI in order to see, whether an insert is present



Fig. 2 Test digestions for the constructs RecA-LacZ (#2.3), SulA-GFP (#3.4) and SulA-LacZ (#4.8). All constructs digested showed the right bands (left gel compared to virtual gel with expected bands on the right). Construct #2.3 gave the expected shift of the lowest band (arrow) compared to the LacZ-control construct (original biobrick BBa_K173004) due to the presence of the RecA promoter.

03/16/2012

  • Miniprep of RecA-GFP clones #18 and #26 inocculated the previous
    • Measurement of DNA concentration with the Nanodrop gave 71 ng/ul for both constructs


  • Test digestion of 1 ug of #18 and #26 with EcoRI/NcoI
    • Band correct for both constructs



  • All constructs (clones #1.18, 2.3, 3.4, 4.8) were send for sequencing to GATC using standard biobrick sequencing primer VF2

03/17/2012

  • Sequencing results were obtained from GATC for the first 4 Biobricks we did
    • Sequence was confirmed for all 4 constructs; cloning was successful!
PartDNA Confirmation
RecA-GFPOK
RecA-LacZOK
SulA-GFPOK
SulA-LacZOK

05/08/2012

Anealing of oligos for RecB and RecC:

Got oligo sequences from pubmed (looked for appropriate ATG and then took the following 70 basepairs as promotor sequence)

RecB: fwd.: aattcgcggccgcttctagag CCTGAAGGCTGGAAAGTGTGGGAGAACGTCAGCGCGTTGCAGCAAACAATGCCCCTGATGAGTGAAAAGA c rev.: ctagg TCTTTTCACTCATCAGGGGCATTGTTTGCTGCAACGCGCTGACGTTCTCCCACACTTTCCAGCCTTCAGG ctctagaagcggccgcg


RecC: fwd.:aattcgcggccgcttctagag TTCACCCGGGGGCAGAGAAGGCGAGATGACCCGCCTGCATTGCCCGAATCGTCAGTAGTCAGGAGCCGCT c rev.: ctagg AGCGGCTCCTGACTACTGACGATTCGGGCAATGCAGGCGGGTCATCTCGCCTTCTCTGCCCCCGGGTGAA ctctagaagcggccgcg


Anealing-Protocol:

  • 5 ul of each oligo (diluted to a concentration of 100 mM)
  • 5 ul of NEB buffer 2
  • 35 ul of water
  • Mix
  • Heat up reaction mix to 95 °C for 5 minutes
  • Cool down slowly to room temperature (then store at -20 °C)


Ligation RecB-LacZ / RecC-lacZ:

Add contents in the following order:

  • 12 ul water
  • 2 ul T4 DNA ligase buffer
  • 4 ul LacZ-backbone
  • 1 ul RecB / RecC
  • 1 ul T4 ligase
  • leave 20 minutes at room temperature
  • heat up to ca. 70°C to destroy ligase-enzymes

Transformation of RecB-LacZ / RecC-LacZ into Top10:

  • Transformation-protocoll missing!

05/26/2012

Colony PCR:
Screening of the two different biobrick clonings done by colony-PCR.

Protocol:
A reaction mix was prepared containing 0.2 ul of each screening primer used for the screening, 9.6 ul of water and 10 ul of 2x PCR mastermix (fermentas). Finally a colony was picked from a plate using a sterile pipette tip and was dipped into the PCR mix a few times. 12 clones were screened for each different cloning setup as follows:

RecB-LacZ: primers VF2: and RecB Reverse: were used. Only in case RecB was successfully cloned into the backbone containing the reporter gene, we would get a PCR product.

RecC-LacZ: primers VF2 and VR (standard sequencing primers) were used. We compared the product size of the different clones to the product size from the original vectors from the registry (only containing recA or LacZ). In case the cloning was successful, we should see a 200 bp shift in product size, which can be detected by gel electrophoresis.

The PCR program was done as follows:
94°C/3min||94°C/30s|60°C/30s|72°C/3min 45s||30x 72°C/10min|4°C/forever Afterwards, 3 ul PCR product were loaded onto a 1 % agarose gel.

05/28/2012

Transferring the parts into standard registry plasmid pSB1C3:

  • Restriction digest of 1µg of each sample and of the standard backbone
  • After 30 min SapI is added to the backbone digest
  • After overall 60 min Qiagen nucleotide removal kit was used to purify DNA
  • heat inactivation of remaining enzymes at 80°C
  • concentration measurement with nanodrop
  • Ligation


  • heat inactivation at 70°C

06/02/2012

Inoculate:

Protocol: Constructs grown as overnightculture on agarplates:

  • #5 RecA_LacZ
  • #7 SulA_LacZ
  • #8 RecB_LacZ
  • #9 RecC_LacZ

A reaction mix was prepared containing 20ml LB medium and 20 µl Chloramphenicol (50mg/µl). Finally a single blue colony (except for #9) was picked from an agar plate using a sterile pipette tip and was dropped into a tube with 2ml of the reaction mix.
Except for #9 we picked two colonies of each plate and inoculated separately. For plate #9, we picked four white colonies to check for basal expression.
After picking the colonies the tubes, in which the pipette tips where dropped, were put into 20ml LB Medium .
Several hours later a miniprep of the grown cultures with the Qiagen Kit followed. DNA was eluted in TE Buffer.
Measurement of DNA concentration with Nanodrop:

  • #5.1 16 ng/µl
  • #5.2 6 ng/µl
  • #7.1 46 ng/µl
  • #7.2 57 ng/µl
  • #8.1 84 ng/µl
  • #8.2 91 ng/µl

06/07/2012

Three parts were sent to the parts registry: You can find all BioBricks under: Parts

Calibration and Characterization


04/27/2012

Transformation of E.coli strain BL21 (DE3) with our constructs the samples were plated on LB agarplates with Ampicillin.

04/28/2012

Inoculation of overnight cultures in LB liquid medium with Amp from the plates.

04/29/2012

Experiment 1:

  • day culture was inoculated with 1:30 dilution of overnight culture in LB with Ampicilin
  • day culture was incubated for 3 h
  • measurement of optical density using a photometer at 600nm to confirm bacterial growth
  • distribution of each 3 ml per sample to 6-well-plates
  • 7 replicate plates one per time span: 0 s, 5 s, 10 s, 30 s, 5 min, 10 min of exposure time
  • Exposure to UV-light in the Intas gel IX imager with the above-mentioned time spans
  • Addition of 30 µl X-Gal (2mg/ ml) to samples #5, #7 (constructs containing LacZ) plates sealed with parafilm
  • Incubation at 37°C, 50 rpm for 45 min, visual color change: LacZ samples became blue
  • measurement of optical density at 600 nm of #5 and #7

Problem: maximum absorption of X-Gal at 615-650 nm interferes with measurement of bacterial density at 600 nm – no change in absorption although blue colour was visible

Experiment 2:

  • overnight cultures centrifuged at 4000 rpm for 7 min
  • pellet resuspended in 25 ml LB Amp
  • The bacterial suspension is again exposed to UV-light with time spans of 0s, 20s, 60s, 300s, 600s.
  • After the exposure X-Gal is added to the samples. Incubation at 37°C, 80rpm
  • first visible color change after 5 min in #7, #5 with X-Gal
  • for a quantification the assays were plated out with duplicates on a 96w-Plate. LB medium was used as a blank reference. ONPG was added and the absorbance was measured with the plate reader
  • ONPG was used because its absorbance maximum differs from the wavelength you use to measure the optical density
  • after that we measured the optical density of our samples using the photometer to get the true expression.


05/27/2012

Repetition of the second experiment at 29/04/2012.

  • overnight cultures centrifuged at 4000 rpm for 7 min
  • pellet resuspended in 25 ml LB Amp
  • The bacterial suspension is again exposed to UV-light with time spans of 10min 8min 6min 4min 2min 0min
  • After the exposure X-Gal is added to the samples. Incubation at 37°C, 80rpm

Experiment failed.
No clear graduation between the samples of different exposure times was observed.
Possible causes: big differences in incubation time after exposure

Improvements in 4. experiment:

  • 24 wellplate recA and sulA
  • for 5 min in Uv light then the first row was transfered to another wellplate. The rest went again for 5 min under UV light, then the second row, with now an time period of 10 min.
  • Same procedure for all the other rows. Time periods 5min 10min 15min 20min 30min and a controll sample with 0min


Fig. 1: Picture of the color gradient visible in the X-Gal assays with different exposure times Testing of the RecA_GFP construct

  • Overnight culture of RecA_GFP was diluted 1:5
  • 3ml of the culture were induced by UV radiation in the gel chamber for 30min
  • The induced culture and 3ml of uninduced culture were incubated for 30min at 37°C / 80rpm
  • After the incubation both cultures were compared using the fluorescence microscope



Fig. 2: Results of the GFP samples underneath fluorescence microscope

05/28/2012


Testing under real life conditions:

  • culture of RecA_LacZ and SulA_LacZ was centrifuged at 4000rpm for 8 min
  • pellet was resuspended in LB Amp
  • the samples were put into 2 6-well plates (3 ml/well)
  • plates were tightly sealed, desinfected and put outdoor either into the sun or shadow for 75 min
  • after 30 min incubation X-Gal was added to final concentration of 200 µg/ml the coloring of the samples were observed over time; intensity of the coloring in the wells were measured using the imageJ software package


06/07/2012

Overnight cultures RecB_LacZ were diluted 1:2 with LB Medium and transferred onto 24-well-plates, 500 µl per well. Duplicates were exposed to UV-radiation in the UV-chamber for 5, 10, 15, 20 and 30 min.
X-Gal stock solution was diluted 1:100.
After 1h incubation 50µl X-Gal was added to final concentration of 200 µg/ml. The coloring of the samples were observed over time. Intensity of the coloring in the wells were measured using the imageJ software package.


Fig. 1: All constructs in comparison