Team:Heidelberg LSL/Notebook

Planning and Development

01/07/2012

Brainstorming for possible project ideas:

Ideas:

• plastics deteriorating bacteria
• anti pus bacteria against acne
• bacterial radiation badge
• bacteria which provide lactose intolerant people with lactase

Members should find more information about the different projects:

• find pro and contra
• did a group already work on these ideas?
• implementation?
• possible BioBricks?

01/21/2012

Presentation of the found information:

• vote and decision → our project for iGEM: bacterial radiation badge

Finding ideas to realize our project:

• implementing our project using the system of the SOS response

=> find promoters which are linked with the SOS response

• how can we see the genetical damage of the DNA caused by radiation?

=> looking for appropriate reporter genes

Work division:

• reporter group
• promoter group

02/04/2012

Presentation of found information:

• chosen and possible promoters: recA (recB, recC, ...) and sulA
• chosen and possible reporters: lacZ and GFP

Working out the construction of our plasmids:
-------> BILD!!!

Decision on BioBricks we want to order:

• part # BBa_K173004 (Beta- galactosidase protein generator)
• BBa_K173004 (not present in any distribution)
• BBa_J22106 (2011 spring distribution, kit plate 1, well 9N, backbone: pSB1A2, resistance: Amp)
• BBa_E0240 (2011 spring distribution, kit plate 1, well 12M, backbone: pSB1A2, resistance: Amp)
• pSB1A2 (2011 spring distribution, kit plate 1, well 11P, resistance: Amp)
• pSB1K3 (2011 spring distribution, kit plate 1, well 5A, resistance: Kan)
• pSB1C3 (2011 spring distribution, kit plate 1, well 3A, resistance: Cm)

02/06/2012

Parts were ordered at iGEM HQ and sent to:

Dr. Barbara Di Ventura
BioQuant, 3. OG
INF267
69120 Heidelberg
Germany

02/19/2012

To do:

• laboratory planning
• looking for appropriate protocols
• looking for a lab → DKFZ, Heidelberg: Prof. Dr. Stephan Herzig

Problem: SulA is not available at the parts registry → we have to order the sequence of SulA, which was found in the parts registry, as oligos. We want to aneal them to double-stranded DNA.

"Life as a toolkit"
Ethically considerations about synthetic biology with Dr. Kartin Platzer and Dr. Markus Thiemel

Biosensor Construction

02/23/2012

• Transformation of GFP (BBa_ E0240) and RecA (BBa_J22106) from registry 2010 spring distribution into E. coli Top10 cells
  
  

Protocol:
10 ul water is added to the corresponding well, DNA is solved by incubation for 15 min at room temperature. 5 ul of DNA solution are added to 50 ul of chemocompetent Top10 cells and incubated on ice for 20 min. Afterwards, a heat shock is performed by incubation the bacteria on 42°C/50 s. After another 2 min on ice, the bacteria are plated onto LB-Amp agar plates.

02/24/2012

• Inoculation of overnight cultures by picking one single colony from the transformed plates and adding it to 5 ml LB-Amp in a 50 ml falcon tube. The culture is incubated at 37 °C at 180 rpm.

• Inoculation of LacZ (BBa_K173004) that we got from the registry through the Sourjik Lab on campus as agar stick into 5 ml LB Amp overnight culture

02/25/2012

• Miniprep of parts BBa_K173004,BBa_ E0240 and BBa_J22106 by using a Qiagen Miniprep Kit
  

Protocol: 4 ml bacterial culture is pelleted by centrifugation at 10.000 rpm for 1 min. Afterwards, the pellet is resuspended in 250 µl buffer P1. 250 µl buffer P2 are added and the culture is gently inverted and incubated for 5 min. 350 µl buffer N3 are added and the suspension is centrifuged at 13.000 rpm for 10 min. The supernatant is subsequently loaded onto a miniprep column and centrifuged for 1 min/max speed. Afterwards the column is washed with buffer PB (500 µl) and buffer PE (750 µl) by loading onto the column and subsequent centrifugation for 1 min/max speed. After a last centrifugation step for drying the column (again 1 min/max speed), 50 µl of water are added in order to dissolve the DNA again. After 1 min incubation, DNA is eluted by centrifugation for 1 min/max speed.

• Measurement of DNA concentration at the Nanodrop micophotometer device

1 µl of water is used as blank. Subsequently, the miniprep cultures ( 1µl each) were loaded onto the Nanodrop device in order to determine the concentration and purity of the DNA in the samples. Concentrations ranged from 70 ng/µl to 300 ng/µl

(PLACEHOLDER: table of DNA concentration).

• Digestion of Minipreps for further cloning

We used the NEB restriction enzymes and buffers for setting up the digestions. Those were done as follows:

• • 1 µg of DNA
  • 3 µl of NEB buffer 2
  • 3 µl of BSA
  • 1 µl of each restriction enzyme used
  • Water was added to reach a final volume of 30 ul

GFP (BBa_ E0240) and LacZ (BBa_K173004) were digested with EcoRI and XbaI. RecA (BBa_J22106) was digested with EcoRI and SpeI. After setting up the digestions, the reaction mixtures were mixed briefly, spinned down in a centrifuge (quick run up to 5.000 rpm) and then incubated on a thermomixer heating device for 1 h at 37 °C and stored at -20 °C afterwards.

• Annealing of SulA oligos:
  

SulA_fw:

aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccaactcacc

SulA_rev:

ctagggtgagttactgtatggatgtacagtacatccagtgacaacaaagatcaacccctctagaagcggccgcg

The Oligos for the synthesis of the SulA promoter were designed according to the sequence available in the partsregistry (BBa_K518010). By annealing of the oligos and ligation into a EcoRI/XbaI precut biobrick construct, they reconstitute the biobrick standard prefix completely and introduce the SulA promoter sequence.

Protocol: 5 ul of each oligo (diluted to a concentration of 100 mM) and 5 µl of NEB buffer 2 were added to 35 µl of water. After mixing, the reaction mix was heated up to 95 °C/5 min and then cooled down slowly to room temperature and then stored at -20 °C.

03/10/2012

• Information: Standard cloning - our Strategy
  • GFP and LacZ were digested with EcoRI (E) and Xbal (X)
  • RecA was digested with EcoRI and SpeI (S)
  • SulA was annealed, so it has the overhangs for EcoRI (as well as the whole BBa prefix) and a XbaI compatible overhang

(PLACEHOLDER: schema of cloning)

• Gelelectrophoresis of the digested biobrick parts in order to extract the GFP and LacZ backbone as well as recA
  

Protocol: In the meantime, the restriction digests were mixed with 6 µl of 6 x Loading Dye (fermentas). The whole restriction digest was loaded onto a 1 % agarose gel. Therefor, the agarose gel was prepared by adding 2 g of agarose to 200 ml of 1x TBE buffer and heated up in a microwave for 2 min/600 W. Thereby, the agarose was melted. Afterwards, the gel was stirred on a magnetic stirring device until the solution reached ~ 60°C and then the gel was poured. 10 µl of ethidium bromide were subsequently added by our supervisor Katharina Genreith (as EtBr is very toxic, we preferred our supervisor to do the handling of that when running a gel for the first time). The samples were then loaded on the gel together with 1kb plus loading ladder (fermentas) and run for 1 h @ 100V. The expected bands can be seen on the figure (picture constructed using the WinSerial Cloner software).

(PLACEHOLDER: figure showing the gel we expect)

(PLACEHOLDER: photo of the gel)

• Gel extraction of the indicated band (backbones for LacZ and GFP as well as recA insert) was done using a Qiagen gel extraction kit.
  

Protocol: The bands were cut of the gel under UV light (caution: wear goggles in order to protect your eyes!) using a scalpel and the extracted band was put into a 2 ml eppi cup. Afterwards, 600 µl of buffer QG were added to each gel band and the mixture was incubated on a thermomixer device at 50 °C and 700 rpm shaking for 20 min. Afterwards, 200 µl of Isopropanol were added to the mix containing recA (as recA is pretty short compared to the others, isopropanol is required). Afterwards, the whole reaction mix was loaded onto a gel extraction column and centrifuged for 1 min/max speed; flow-through was discarded. The column was subsequently washed with 500 µl of buffer QG and then 750 µl buffer PE, always centrifuging the column at max speed for 1 min at each washing step and discarding the flow-through. Finally, DNA was eluted in 20 µl of water.

• Concentration measurement of the pre-cut parts using Nanodrop

Part	DNA concentration
GFP	12.5 ng/µl
LacZ	15.11 ng/µl
RecA	6.0 ng/µl

03/13/2012

• Ligation reactions were set up using 3-6 fold access of insert (RecA) and 50 ng of each backbone (roughly).
  • • RecA-GFP: 4 µl (~50 ng) GFP-backbone + 1,5 µl (~9 ng) RecA + 2 µl T4 DNA ligase buffer + 11,5 µl water + 1 µl T4 ligase
    • RecA-LacZ: 3 µl (~50 ng) LacZ-backbone + 1,5 µl (~9 ng) RecA + 2 µl T4 DNA ligase buffer + 12 µl water + 1 µl T4 ligase
    • SulA-GFP: 4 µl (~50 ng) GFP-backbone + 1 µl annealed SulA-oligos + 2 µl buffer + 12 µl water + 1 µl T4 ligase
    • SulA-LacZ: 3 µl (~50 ng) LacZ-backbone + 1 µl annealed SulA-oligos + 2 µl buffer + 13 µl water + 1 µl T4 ligase
  • Incubation for 50 min at room temperature
  • Heat inactivation of the T4 ligase at 70 °C for 5 min
• Afterwards, 10 µl of the ligation mix (chilled) were used for transforming 50 µl of E. coli Top10 chemocompetent cells.

03/14/2012

• Screening of the four different biobrick clonings done by colony-PCR.
  

Protocol:
A reaction mix was prepared containing 0.2 µl of each screening primer used for the screening, 9.6 µl of water and 10 µl of 2x PCR mastermix (fermentas). Finally a colony was picked from a plate using a sterile pipette tip and was dipped into the PCR mix a few times. 7-8 clones were screened for each different cloning setup as follows:

• • SulA-GFP and SulA-LacZ: primers SulA_fw and VR (standard sequencing primer) were used. Only in case SulA was successfully cloned into the backbone containing the reporter gene, we would get a PCR product. GFP would give a product of roughly 1000 bp, LacZ one of roughly 3500 bp.
    
  • RecA-GFP and RecA-LacZ: primers VF2 and VR (standard sequencing primers) were used. We compared the product size of the different clones to the product size from the original vectors from the registry (only containing recA or LacZ). In case the cloning was successful, we should ssee a 200 bp shift in product size, which can be detected by gel electrophoresis.
    

The PCR program was done as follows:

94°C/3min||94°C/30s|60°C/30s|72°C/3min 45s||30x 72°C/10min|4°C/forever

Afterwards, 3 ul PCR product were loaded onto a 1 % agarose gel.



Fig. 1 Colony-PCR screen of RecA-GFP construct. No detectable shift of any screened clone can be seen compared to the control. Screen has to be repeated.


Fig. 2 Colony-PCR screen of RecA-LacZ construct. Most clones show a small shift upwards in product length. Furthermore, they show a second band at 1200 bp, probably due to unspecific primer binding.


Fig. 3 Colony-PCR screen of SulA-GFP (#3.1-3.8) and SulA-LacZ (#4.1-4.8). Only clones containing the SulA promoter can give a PCR product of 1000 bp (SulA-GFP) or 3700 bp (SulA-LacZ). Positive clones are i.e. #3.4, #4.2, #4.8.

The screening gave positive clones for all constructs (fig. 2, fig. 3), but not the recA-GFP construct (fig. 1). Therefore this screen has to be repeated using a larger number of colonies.

• 5 ml LB-Amp overnight cultures were inoculated for clones #2.3, #3.4 and #4.8.

03/15/2012

• The colony-PCR for the recA-GFP construct was repeated, now screening a number of 31 colonies. As control, again the amplicon of the original GFP biobrick was used.
  

Fig. 1 Repetition of colony-PCR for RecA-GFP construct. Clones #6, 18 and 26 were positive (shift in amplicon length of ~200 bp).

3 positive colonies were detected, as they show a shift in band size of ~ 200 bp as expected by the introduction of the recA promoter. Those were clones # 6, 18 and 26.

• O/n LB-amp cultures were inoculated for clones #18 and #26.
  

• Miniprep of the o/n cultures inoculated the day before for clones #2.3, 3.4 and 4.8 were done.
  
  • concentrations measured using Nanodrop are all in between 70 and 140 ng/µl
    

• Test digestions were performed in order to detect, whether the constructs would give the expected band patterns on the gel.
  • #2.3 with EcoRI/BglI; as control the original LacZ biobrick was digested EcoRI/BgII as well
  • #3.4 and #4.8 were digested NotI in order to see, whether an insert is present
    

Fig. 2 Test digestions for the constructs RecA-LacZ (#2.3), SulA-GFP (#3.4) and SulA-LacZ (#4.8). All constructs digested showed the right bands (left gel compared to virtual gel with expected bands on the right). Construct #2.3 gave the expected shift of the lowest band (arrow) compared to the LacZ-control construct (original biobrick BBa_K173004) due to the presence of the RecA promoter.

03/16/2012

• Miniprep of RecA-GFP clones #18 and #26 inocculated the previous
  • Measurement of DNA concentration with the Nanodrop gave 71 ng/ul for both constructs
    

• Test digestion of 1 ug of #18 and #26 with EcoRI/NcoI
  • Band correct for both constructs

• All constructs (clones #1.18, 2.3, 3.4, 4.8) were send for sequencing to GATC using standard biobrick sequencing primer VF2

03/17/2012

05/08/2012

05/26/2012

Calibration and Characterization

04/27/2012

04/28/2012

04/29/2012

05/27/2012

05/28/2012

Notebook - Dates

Planning and Development

01/07/2012	02/19/2012
01/21/2012	06/02/2012
02/04/2012	06/09/2012
02/06/2012

Biosensor-Construction

02/23/2012	03/16/2012
02/24/2012	03/17/2012
02/25/2012	05/08/2012
03/10/2012	05/26/2012
03/13/2012	06/02/2012
03/14/2012	06/07/2012
03/15/2012

Calibration and Characterization

04/27/2012	05/27/2012
04/28/2012	05/28/2012
04/29/2012	06/07/2012