Team:Heidelberg LSL/Notebook materials

From 2012hs.igem.org

(Difference between revisions)
 
(36 intermediate revisions not shown)
Line 1: Line 1:
-
{{Top}}
+
{{TopII}}
{{Stylesheet}}
{{Stylesheet}}
Line 7: Line 7:
-
#bodyContent { background-color: transparent; border: none; width: 975px; min-height: 900px;}
+
#bodyContent { background-color: transparent; border: none; width: 975px; min-height: 2900px;}
-
 
+
#news {min-height: 2900px;}
<script type="text/javascript">
<script type="text/javascript">
function setPageSize() {
function setPageSize() {
Line 24: Line 24:
<br>
<br>
-
<h4>Kits for Plasmid and DNA purification</h4>
+
<h4>Kits for purification of plasmid-DNA and DNA fragments</h4>
 +
 
 +
<p>DNA was extracted in small or medium scale using the Promega or Qiagen DNA preparation kits. For all DNA extractions before digestions/transformations, Promega Kits were applied. Only when performing sequencing, Qiagen kits were preferred.</p>
 +
 
<center>
<center>
-
<table  class="wikitable sortable" border="0" style="text-align:left >
+
<table  class="wikitable sortable" border="0" style="text-align:left"  width="600px">
<caption align="top, left">
<caption align="top, left">
Line 37: Line 40:
   <a href="http://www.promega.com/b/de/aufreinigung/minis/default.aspx">PureYield™ Plasmid Miniprep System
   <a href="http://www.promega.com/b/de/aufreinigung/minis/default.aspx">PureYield™ Plasmid Miniprep System
</a>  
</a>  
-
  </p></td><td>small scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains </td><td>Promega</td>
+
  </p></td><td>small scale plasmid purification from <i>E. coli</i> Top10 cells before digestion or transformation into different <i>E. coli</i> strains </td><td>Promega</td>
</tr>
</tr>
Line 44: Line 47:
   <a href="http://www.qiagen.com/dm/aw/miniprep/default.aspx?gaw=QVenGA3Miniprep&gkw=miniprep+kit">QIAprep Spin MiniPrep Kit (50)
   <a href="http://www.qiagen.com/dm/aw/miniprep/default.aspx?gaw=QVenGA3Miniprep&gkw=miniprep+kit">QIAprep Spin MiniPrep Kit (50)
</a>  
</a>  
-
  </p></td><td>small scale plasmid purification from E. coli Top10 cells before sequencing </td><td>Qiagen</td>
+
  </p></td><td>small scale plasmid purification from <i>E. coli</i> Top10 cells before sequencing </td><td>Qiagen</td>
</tr>
</tr>
Line 51: Line 54:
   <a href="http://www.promega.com/products/dna-and-rna-purification/plasmid-purification/pureyield-plasmid-midiprep-system/">PureYield™ Plasmid Midiprep System
   <a href="http://www.promega.com/products/dna-and-rna-purification/plasmid-purification/pureyield-plasmid-midiprep-system/">PureYield™ Plasmid Midiprep System
</a>  
</a>  
-
  </p></td><td>medium scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains </td><td>Promega</td>
+
  </p></td><td>medium scale plasmid purification from <i>E. coli</i> Top10 cells before digestion or transformation into different <i>E. coli</i> strains </td><td>Promega</td>
</tr>
</tr>
Line 71: Line 74:
</center>
</center>
 +
<h4>LB growth media - components an recipe</h4>
 +
 +
<p>LB media was prepared from 10 g/l tryptone, 5 g/l yeast extract and 5 g/l NaCl and autoclaved before usage. For preparing LB agar plates, 1.5 g of agar were added to the media. The media was furthermore substituted with 100 ug/ml ampicillin (for LB-amp) or 35 ug/ul chloramphenicol (for LB-cm).</p>
 +
 +
 +
<center>
 +
<table  class="wikitable sortable" border="0" style="text-align:left" width="600px" >
 +
 +
<caption align="top, left">
 +
</caption><tr bgcolor="#cccccc">
 +
<td> Name</td><td>Usage</td><td>Company</td></tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.bd.com/ds/productCenter/211701.asp">Trypton
 +
</a>
 +
</p></td><td>LB media </td><td>BD</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.bd.com/ds/productCenter/288620.asp">Yeast Extract
 +
</a>
 +
</p></td><td>LB media </td><td>BD</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/programs/research-essentials-products.html?TablePage=102880799">NaCl
 +
</a>
 +
</p></td><td>LB media </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/analytical-chromatography/microbiology/basic-ingredients/agar.html">Agar
 +
</a>
 +
</p></td><td>preparing agar plates </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/catalog/search?interface=All&term=ampicillin&lang=de&region=DE&focus=product&N=0+220003048+219853101+219853286&mode=match%20partialmax">Ampicillin
 +
</a>
 +
</p></td><td>usage: 100 ug/ml, selection of plasmid containing an amp resistance gene </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/catalog/product/sigma/c3175?lang=de&region=DE">Chloramphenicol
 +
</a>
 +
</p></td><td>usage: 35 ug/ml, selection of plasmid containing an Cm resistance gene </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/labware/labware-products.html?TablePage=17951483">petri dish (10 cm)
 +
</a>
 +
</p></td><td>preparing agar plates </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/catalog/product/sial/b4252?lang=de&region=DE">X-Gal
 +
</a>
 +
</p></td><td>dissolve in DMSO at 20 mg/ml. final concentration for blue-white screening: 100 ug/ml and for X-Gal assays in liquid LB culture: 200 ug/ml</td><td>Sigma</td>
 +
</tr>
 +
 +
 +
</table>
 +
</center>
 +
 +
<br>
 +
 +
<br>
 +
 +
<h4><i>E. coli</i> Strains</h4>
 +
 +
<p><i>E. coli</i> Top10 were used for amplification of plasmid DNA and subsequent DNA substraction. Bl21(DE3) were used in all measurments/assays performed.</p>
 +
 +
 +
<center>
 +
<table  class="wikitable sortable" border="0" style="text-align:left" width="600px" >
 +
 +
<caption align="top, left">
 +
</caption><tr bgcolor="#cccccc">
 +
<td> Strain</td><td>Genotype</td></tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://openwetware.org/wiki/E._coli_genotypes">Top10
 +
</a>
 +
</p></td><td>F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://openwetware.org/wiki/E._coli_genotypes">Bl21(DE3)
 +
</a>
 +
</p></td><td>F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) </td>
 +
</tr>
 +
 +
 +
</table>
 +
</center>
 +
 +
<br>
Line 76: Line 186:
<center>
<center>
-
<table  class="wikitable sortable" border="0" style="text-align:left >
+
<table  class="wikitable sortable" border="0" style="text-align:left" width="600px" >
<caption align="top, left">
<caption align="top, left">
Line 98: Line 208:
<tr>
<tr>
<td><p>
<td><p>
-
   <a href="http://www.promega.com/products/cloning-and-dna-markers/restriction-enzymes/xbai/">PureYield™ Plasmid Midiprep System
+
   <a href="http://www.promega.com/products/cloning-and-dna-markers/restriction-enzymes/xbai/">XbaI
</a>  
</a>  
  </p></td><td>restriction enzyme, recognition sequence: TCTAGA</td><td>Promega or NEB</td>
  </p></td><td>restriction enzyme, recognition sequence: TCTAGA</td><td>Promega or NEB</td>
Line 107: Line 217:
   <a href="http://www.promega.com/products/cloning-and-dna-markers/restriction-enzymes/psti/">PstI
   <a href="http://www.promega.com/products/cloning-and-dna-markers/restriction-enzymes/psti/">PstI
</a>  
</a>  
-
  </p></td><td>restriction enyzme, recognition sequence: CTGCAG</td><td>Promega or NEB</td>
+
  </p></td><td>restriction enzyme, recognition sequence: CTGCAG</td><td>Promega or NEB</td>
</tr>
</tr>
Line 126: Line 236:
</center>
</center>
 +
<br>
<h4>Oligonucleotides</h4>
<h4>Oligonucleotides</h4>
<p>Oligos were annealed and subsequently cloned into EcoRI/XbaI predigested reporter backbones. Thereby short synthetic DNA-sequences (in this case for the promoters psulA, precA and precB) can be generated in a fast and easy manner.</p>
<p>Oligos were annealed and subsequently cloned into EcoRI/XbaI predigested reporter backbones. Thereby short synthetic DNA-sequences (in this case for the promoters psulA, precA and precB) can be generated in a fast and easy manner.</p>
-
</br>
+
 
<center>
<center>
-
<table  class="wikitable sortable" border="0" style="text-align:left >
+
<table  class="wikitable sortable" border="0" style="text-align:left" width="600px" >
<caption align="top, left">
<caption align="top, left">
Line 142: Line 253:
<tr>
<tr>
<p>
<p>
-
<td>SulA_fw</td><td>aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccatacagtaactcacc</td><td>74</td>
+
<td>psulA_fw</td><td>5'-aattcgcggccgcttctagagGGGTTGATCTTTGTTGT CACTGGATGTACTGTACATCCATACAGTAACTCACc-3'</td><td>74</td>
 +
</p>
 +
</tr>
 +
 
 +
<tr>
 +
<p>
 +
<td>psulA_rev</td><td>5'-ctaggGTGAGTTACTGTATGGATGTACAGTACATCCAG TGACAACAAAGATCAACCCctctagaagcggccgcg-3'</td><td>74</td>
 +
</p>
 +
</tr>
 +
 
 +
<tr>
 +
<p>
 +
<td>precB_fw</td><td>5'aattcgcggccgcttctagagCCTGAAGGCTGGAAAGTGTGGGAGA ACGTCAGCGCGTTGCAGCAAACAATGCCCCTGATGAGTGAAAAGAc-3'</td><td>92</td>
 +
</p>
 +
</tr>
 +
 
 +
<tr>
 +
<p>
 +
<td>precB_rev</td><td>5'-ctaggTCTTTTCACTCATCAGGGGCATTGTTTGCTGCAACGCGCTG ACGTTCTCCCACACTTTCCAGCCTTCAGGctctagaagcggccgcg-3'</td><td>92</td>
 +
</p>
 +
</tr>
 +
 
 +
<tr>
 +
<p>
 +
<td>precC_fw</td><td>5'-aattcgcggccgcttctagagTTCACCCGGGGGCAGAGAAGGC GAGATGACCCGCCTGCATTGCCCGAATCGTCAGTAGTCAGGAGCCGCTc-3'</td><td>92</td>
 +
</p>
 +
</tr>
 +
 
 +
<tr>
 +
<p>
 +
<td>precC_rev</td><td>5'-ctaggAGCGGCTCCTGACTACTGACGATTCGGGCAATGCAGGCG GGTCATCTCGCCTTCTCTGCCCCCGGGTGAActctagaagcggccgcg-3'</td><td>92</td>
</p>
</p>
</tr>
</tr>
Line 149: Line 290:
</center>
</center>
 +
<br>
 +
 +
 +
 +
<h4>Gel electrophoresis</h4>
 +
 +
<p>For gel electrophoresis we used 1 % agarose dissolved in 1x TAE buffer. Gels were run at 110 V for 25-60 min.</p>
 +
 +
 +
<center>
 +
<table  class="wikitable sortable" border="0" style="text-align:left" width="600px" >
 +
 +
<caption align="top, left">
 +
</caption><tr bgcolor="#cccccc">
 +
<td> Name</td><td>Usage</td><td>Company</td></tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/catalog/search?interface=All&term=agarose&lang=de&region=DE&focus=product&N=0+220003048+219853101+219853286&mode=match%20partialmax">Agarose
 +
</a>
 +
</p></td><td>to be dissolved to 1 % in 1x TAE buffer </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sigmaaldrich.com/catalog/search?interface=All&term=TAE+buffer&lang=de&region=DE&focus=product&N=0+220003048+219853101+219853286&mode=match%20partialmax">TAE buffer
 +
</a>
 +
</p></td><td>Tris-Acetate-EDTA buffer for gel electrophoresis </td><td>Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.promega.com/products/biochemicals-and-labware/biochemical-buffers-and-reagents/blue_orange-loading-dye_-6x/">Blue/Orange loading dye, 6x
 +
</a>
 +
</p></td><td>dissolve to 1x in DNA samples before loading onto agarose gel </td><td>Promega</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.promega.com/products/cloning-and-dna-markers/molecular-weight-markers/dna-ladders/">1kb DNA ladder
 +
</a>
 +
</p></td><td>1kb DNA ladder </td><td>Promega</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.fermentas.com/en/products/all/dna-electrophoresis/generuler-dna-ladders/sm033-generuler-mix">GeneRuler DNA ladder Mix
 +
</a>
 +
</p></td><td>DNA ladder mix, 100 bp - 10 kb </td><td>Fermentas</td>
 +
</tr>
 +
 +
 +
</table>
 +
</center>
 +
 +
<br>
 +
 +
 +
<h4>Measurements</h4>
 +
 +
<p>The following materials and devices were used for our measurements and assays (DNA concentration, ONPG- and X-Gal assay) </p>
 +
 +
 +
<center>
 +
<table  class="wikitable sortable" border="0" style="text-align:left" width="600px" >
 +
 +
<caption align="top, left">
 +
</caption><tr bgcolor="#cccccc">
 +
<td> Name</td><td>Usage</td><td>Company</td></tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.nanodrop.com/Productnd2000overview.aspx">NanoDrop 2000
 +
</a>
 +
</p></td><td>measurement of DNA concentration and purity </td><td>Thermo Scientific</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://catalog.bd.com/bdCat/viewProduct.doCustomer?productNumber=353046">6-well plate, polysterene
 +
</a>
 +
</p></td><td>light induction in UV-illumination chamber </td><td>BD, Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://catalog.bd.com/bdCat/viewProduct.doCustomer?productNumber=353047">24-well plate, polysterene
 +
</a>
 +
</p></td><td>light induction in UV-illumination chamber </td><td>BD, Sigma</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.sarstedt.com/php/main.php?newlanguage=en">Cuvettes
 +
</a>
 +
</p></td><td>visualization purposes </td><td>Sarstedt</td>
 +
</tr>
 +
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.intas.de/geldokumentation-gel-ix-imager">Intas Gel IX Imager
 +
</a>
 +
</p></td><td>Gel Documentation and UV-illumination of Bl21(DE3) <i>E.coli</i> transformed with radiation sensing constructs; illumination wavelength: 312 nm </td><td>Intas</td>
 +
</tr>
 +
 +
<tr>
 +
<td><p>
 +
  <a href="http://www.berthold.com/en/bio/product/mithras-lb-940-multimode-microplate-reader">Plate Reader
 +
</a>
 +
</p></td><td>ONPG Assay </td><td>Berthold Technologies</td>
 +
</tr>
 +
 +
</table>
 +
</center>
<p>&nbsp;</p>
<p>&nbsp;</p>
</div><!--end SubWrapper-->
</div><!--end SubWrapper-->
 +
 +
<div id="news">
 +
 +
</div><!--end news-->
</div> <!-- end super_main_wrapper>
</div> <!-- end super_main_wrapper>

Latest revision as of 02:50, 17 June 2012

iGEM-2012HS - LSL-Heidelberg iGEM-2012HS - LSL-Heidelberg


Kits for purification of plasmid-DNA and DNA fragments

DNA was extracted in small or medium scale using the Promega or Qiagen DNA preparation kits. For all DNA extractions before digestions/transformations, Promega Kits were applied. Only when performing sequencing, Qiagen kits were preferred.

NameProduct DescriptionCompany

PureYield™ Plasmid Miniprep System

small scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains Promega

QIAprep Spin MiniPrep Kit (50)

small scale plasmid purification from E. coli Top10 cells before sequencing Qiagen

PureYield™ Plasmid Midiprep System

medium scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains Promega

QIAquick Nucleotide Removal Kit

direct purification of DNA after restriction digestsQiagen

QIAquick Gel Extraction Kit (50)

Purification of DNA fragements from agarose gelQiagen

LB growth media - components an recipe

LB media was prepared from 10 g/l tryptone, 5 g/l yeast extract and 5 g/l NaCl and autoclaved before usage. For preparing LB agar plates, 1.5 g of agar were added to the media. The media was furthermore substituted with 100 ug/ml ampicillin (for LB-amp) or 35 ug/ul chloramphenicol (for LB-cm).

NameUsageCompany

Trypton

LB media BD

Yeast Extract

LB media BD

NaCl

LB media Sigma

Agar

preparing agar plates Sigma

Ampicillin

usage: 100 ug/ml, selection of plasmid containing an amp resistance gene Sigma

Chloramphenicol

usage: 35 ug/ml, selection of plasmid containing an Cm resistance gene Sigma

petri dish (10 cm)

preparing agar plates Sigma

X-Gal

dissolve in DMSO at 20 mg/ml. final concentration for blue-white screening: 100 ug/ml and for X-Gal assays in liquid LB culture: 200 ug/mlSigma


E. coli Strains

E. coli Top10 were used for amplification of plasmid DNA and subsequent DNA substraction. Bl21(DE3) were used in all measurments/assays performed.

StrainGenotype

Top10

F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-

Bl21(DE3)

F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

Enzymes

NameProduct DescriptionCompany

EcoRI

restriction enzyme, recognition sequence: GAATTC Promega or NEB

SpeI

restriction enzyme, recognition sequence: ACTAGT Promega or NEB

XbaI

restriction enzyme, recognition sequence: TCTAGAPromega or NEB

PstI

restriction enzyme, recognition sequence: CTGCAGPromega or NEB

T4 DNA ligase

Ligation of DNA fragmentsPromega or Fermentas

2x PCR MasterMix

Standard Taq PCR master mix for robust amplification of DNA-Fragments by PCR; used for colony-PCR screensFermentas

Oligonucleotides

Oligos were annealed and subsequently cloned into EcoRI/XbaI predigested reporter backbones. Thereby short synthetic DNA-sequences (in this case for the promoters psulA, precA and precB) can be generated in a fast and easy manner.

Oligo NameOligo Sequencesequence length
psulA_fw5'-aattcgcggccgcttctagagGGGTTGATCTTTGTTGT CACTGGATGTACTGTACATCCATACAGTAACTCACc-3'74
psulA_rev5'-ctaggGTGAGTTACTGTATGGATGTACAGTACATCCAG TGACAACAAAGATCAACCCctctagaagcggccgcg-3'74
precB_fw5'aattcgcggccgcttctagagCCTGAAGGCTGGAAAGTGTGGGAGA ACGTCAGCGCGTTGCAGCAAACAATGCCCCTGATGAGTGAAAAGAc-3'92
precB_rev5'-ctaggTCTTTTCACTCATCAGGGGCATTGTTTGCTGCAACGCGCTG ACGTTCTCCCACACTTTCCAGCCTTCAGGctctagaagcggccgcg-3'92
precC_fw5'-aattcgcggccgcttctagagTTCACCCGGGGGCAGAGAAGGC GAGATGACCCGCCTGCATTGCCCGAATCGTCAGTAGTCAGGAGCCGCTc-3'92
precC_rev5'-ctaggAGCGGCTCCTGACTACTGACGATTCGGGCAATGCAGGCG GGTCATCTCGCCTTCTCTGCCCCCGGGTGAActctagaagcggccgcg-3'92

Gel electrophoresis

For gel electrophoresis we used 1 % agarose dissolved in 1x TAE buffer. Gels were run at 110 V for 25-60 min.

NameUsageCompany

Agarose

to be dissolved to 1 % in 1x TAE buffer Sigma

TAE buffer

Tris-Acetate-EDTA buffer for gel electrophoresis Sigma

Blue/Orange loading dye, 6x

dissolve to 1x in DNA samples before loading onto agarose gel Promega

1kb DNA ladder

1kb DNA ladder Promega

GeneRuler DNA ladder Mix

DNA ladder mix, 100 bp - 10 kb Fermentas

Measurements

The following materials and devices were used for our measurements and assays (DNA concentration, ONPG- and X-Gal assay)

NameUsageCompany

NanoDrop 2000

measurement of DNA concentration and purity Thermo Scientific

6-well plate, polysterene

light induction in UV-illumination chamber BD, Sigma

24-well plate, polysterene

light induction in UV-illumination chamber BD, Sigma

Cuvettes

visualization purposes Sarstedt

Intas Gel IX Imager

Gel Documentation and UV-illumination of Bl21(DE3) E.coli transformed with radiation sensing constructs; illumination wavelength: 312 nm Intas

Plate Reader

ONPG Assay Berthold Technologies