Team:Heidelberg LSL/Notebook materials

From 2012hs.igem.org

(Difference between revisions)
Line 139: Line 139:
</caption><tr bgcolor="#cccccc">
</caption><tr bgcolor="#cccccc">
<td> Oligo Name</td><td>Oligo Sequence</td><td>sequence length</td></tr>
<td> Oligo Name</td><td>Oligo Sequence</td><td>sequence length</td></tr>
 +
 +
<tr>
 +
<p>
 +
<td>SulA_fw</td><td>aattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccatacagtaactcacc</td><td>74</td>
 +
</p>
 +
</tr>
 +
 +
</table>
 +
</center>

Revision as of 14:20, 11 June 2012

iGEM-2012HS - LSL-Heidelberg iGEM-2012HS - LSL-Heidelberg


Kits for Plasmid and DNA purification

NameProduct DescriptionCompany

PureYield™ Plasmid Miniprep System

small scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains Promega

QIAprep Spin MiniPrep Kit (50)

small scale plasmid purification from E. coli Top10 cells before sequencing Qiagen

PureYield™ Plasmid Midiprep System

medium scale plasmid purification from E. coli Top10 cells before digestion or transformation into different E. coli strains Promega

QIAquick Nucleotide Removal Kit

direct purification of DNA after restriction digestsQiagen

QIAquick Gel Extraction Kit (50)

Purification of DNA fragements from agarose gelQiagen

Enzymes

NameProduct DescriptionCompany

EcoRI

restriction enzyme, recognition sequence: GAATTC Promega or NEB

SpeI

restriction enzyme, recognition sequence: ACTAGT Promega or NEB

PureYield™ Plasmid Midiprep System

restriction enzyme, recognition sequence: TCTAGAPromega or NEB

PstI

restriction enyzme, recognition sequence: CTGCAGPromega or NEB

T4 DNA ligase

Ligation of DNA fragmentsPromega or Fermentas

2x PCR MasterMix

Standard Taq PCR master mix for robust amplification of DNA-Fragments by PCR; used for colony-PCR screensFermentas

Oligonucleotides

Oligos were annealed and subsequently cloned into EcoRI/XbaI predigested reporter backbones. Thereby short synthetic DNA-sequences (in this case for the promoters psulA, precA and precB) can be generated in a fast and easy manner.


Oligo NameOligo Sequencesequence length
SulA_fwaattcgcggccgcttctagaggggttgatctttgttgtcactggatgtactgtacatccatacagtaactcacc74